Nucleic acid sequence - PDFSEARCH.IO - Document Search Engine

Nucleic acid sequence
Results: 681

#	Item
81	Figure S1: Summary of the emulsion PCR (emPCR) process Light strand 5‘TAGACGTCATTCAGGTGCCAAACGACTTAACGGGATTAC ATCTGCAGTAAGTCCACGGTTTGCTGAATTGCCCTAATG‘5 dnarts yvaeH 1a) Original template molecules are fragmented and Add to Reading List Source URL: rw.mammoth.psu.edu Language: English - Date: 2008-12-01 13:55:23 Genetics DNA Biotechnology Base pair Nucleic acid sequence Complementarity Pyrosequencing Polymerase chain reaction 454 Life Sciences Biology Molecular biology DNA sequencing
82	Journal of Biotechnology–193 Classification of hyper-variable Corynebacterium glutamicum surface-layer proteins by sequence analyses and atomic force microscopy Nicole Hansmeier a,b , Frank W. Bartels c Add to Reading List Source URL: roslab.physics.asu.edu Language: English - Date: 2010-01-04 11:29:44 Protein biosynthesis Corynebacterineae Molecular biology Corynebacterium Gram-positive bacteria Nucleic acid sequence Genetic code Translation Hox gene Biology Biochemistry Gene expression
83	Nucleic Acids Research Advance Access published December 8, 2006 Nucleic Acids Research, 2006, Vol. 00, No. 00 1–10 doi:nar/gkl483 Recharacterization of ancient DNA miscoding lesions: insights in the era of seq Add to Reading List Source URL: rw.mammoth.psu.edu Language: English - Date: 2008-12-01 13:55:22 Molecular biology DNA repair Nucleic acid sequence Polymerase chain reaction Deamination RNA Sticky and blunt ends Nuclease Nucleic acid Biology Genetics DNA
84	Medical Management of Kabuki Syndrome Compiled by Margot Schmiedge and Peta Colton Welcome Families and Professionals Add to Reading List Source URL: www.sakks.org Language: English - Date: 2013-04-26 10:06:48 Kabuki syndrome Mutation Gene Frameshift mutation Medical genetics Exome sequencing DNA Cleft lip and palate Nucleic acid sequence Biology Genetics Human genome
85	A Striking Property of Genetic Code-like Transformations Add to Reading List Source URL: www.complex-systems.com Language: English - Date: 2012-09-20 14:36:17 Protein biosynthesis Molecular biology Molecular genetics Messenger RNA Gene Translation Nucleic acid sequence RNA DNA Biology Gene expression Genetics
86	SUPPLEMENTAL INFORMATION Recharacterization of ancient DNA miscoding lesions: Insights in the era of the GS20 M Thomas P Gilbert, Jonas Binladen, Webb Miller, Carsten Wiuf, Eske Willerslev, Add to Reading List Source URL: rw.mammoth.psu.edu Language: English - Date: 2008-12-01 13:55:23 Genetics Biotechnology DNA Polymerase chain reaction Nucleic acid sequence Pyrosequencing 454 Life Sciences Gene Deamination Biology Molecular biology DNA sequencing
87	ACMG CF Mutation Panel - HGVS Nomenclature cDNA Sequence Change Nomenclature c.1521_1523delCTT/ c.2988+1G>T (AJ575003.1:g.305G>T) c.489+1G>T (AJ574942.1:g.240G>T) c.350G>A Add to Reading List Source URL: wwwn.cdc.gov Language: English - Date: 2013-02-13 14:45:06 Nucleic acid sequence Mutation Complementary DNA Philosophy of biology DNA 1G Biology
88	Nucleic Acids Research, 2007, Vol. 35, Web Server issue W675–W677 doi:nar/gkm267 eProbalign: generation and manipulation of multiple sequence alignments using partition function posterior probabilities Add to Reading List Source URL: www.ncbi.nlm.nih.gov Language: English Biostatistics Sequence alignment Multiple sequence alignment MUSCLE Clustal MAFFT ProbCons Nucleic acid structure prediction Phylo Computational phylogenetics Bioinformatics Science
89	Guiding Principles of Bacteriophage Genome Annotation OBJECTIVE This protocol contains the guiding principles of bacteriophage genome annotation. Printing these pages, reading them carefully, and having them close at han Add to Reading List Source URL: phagesdb.org Language: English - Date: 2013-06-12 15:32:10 Protein biosynthesis Genetics Molecular biology Gene Genome project Transfer RNA Nucleic acid sequence DNA Promoter Biology Gene expression Molecular genetics
90	LimsPortal and BonsaiLIMS: development of a lab information management system for translational medicine Add to Reading List Source URL: www.scfbm.org Language: English DNA sequencing Scripting languages Computational phylogenetics Pileup format Molecular biology Sequence alignment Nucleic acid sequence JRuby BioRuby Bioinformatics Science Biology

UPDATE